Anfrage an NCSoft wegen language Disctricts

[gracjanski]

meine Nachricht:

Zitat:

---

When do you want to remove this change in the game for european gamers? It was not only easier to find guys for a mission or a quest, because many districts are simple empty. Most of the players loves to play with players from other country. I enjoy such teams as well and hope to see a removal of such districts. If not, I will go to US Servers , although I prefer to play on EU because of the time differences.

---

die Antwort:

Zitat:

---

Hello, Thanks for contacting the Guild Wars customer support. We received your ticket, and will forward it to our Billing-Team which is handling requests like yours. Please update your request with the following information:
- Your Retail CD-Key
- A scan of your Retail CD-Key
- A scan of the receipt you got when you purchased Guild Wars

Thank you very much for your patience and understanding.

Kind regards,
GM Julien
NCsoft Europe Guild Wars Customer Support http://www.guildwars.com

---

völlig durchgeknallt. Ich glaub, ich schreib zurück, it is a joke isnt it.
Oder
oh my credit card is 2346773452 and this is my DNA on chromosom 12:

acgaatctagctgctagctacgactgatcactagctgtagctacgtacgtgtacgatcactgactagctagcatatcgatcttctgctgtgctgctagct acattcatcg...

[Floix]

Das is ja wohl der Hammer diese Antwort! rofl
Wie sinnfrei!

Kann halt mal passieren wenn du Support von einem kostenlosen Onlinespiel erwartest

Nehm's mir net übel aber ich musste deine Anfrage auch 4 mal durchlesen bis ich den Sinn verstanden hatte.

[AmunRa]

Wenn ich jetzt nicht wüsste, dass du die Districts meinst würde ich ehrlich gesagt total im Dunkeln tappen was du willst. Naja ich habe das ganze ja vor einiger Zeit mal den Devs vorgetragen, was daraus geworden ist kann man ja sehen, mehr kann ich nicht sagen.

[LordSeth]

Das scheint mir wie ein automatisches Rückschreiben auszusehen

Vielleicht bekommst du doch noch ne richtige Antwort in nächster Zeit.

[anpera]

Warum schreibst du den englischen Support an? Versuchs mit dem deutschen Support, da ist die Chancce größer, dass ihr euch gegenseitig versteht.

[Loos]

Also ich habe deine Anfrage mit dem ersten Lesen kapiert. Allein am ersten Satz erkennts man ja. Und die Antwort ist echt geil sinnfrei

[MasterZelgadis]

Die Antwort ist nicht sinnfrei sondern eine Standardantwort die von einem Mailbot automatisch geschickt wird. Das macht jedes größere Unternehmen dieser Art.

Veränderungen wurden viele gemacht, wenn du etwas willst dann musst du es konkret schreiben.

[gracjanski]

in der Anfrage gibt es noch eine Angeabe zu Titel, und dort habe ich natürlich language Districts hingeschrieben, damit ist klar, was los ist

Ansonsten ist es wohl klar und deutlich geschrieben, was für grosse Nachteile diese Änderung mit sich gebracht hat.

Was ich noch hammer finde... es werden so heftige Daten nachgefragt. Alleine den CDE Key werde ich wohl nie im Leben per Mail oder sonstwie am PC eingeben. Standard ist so etwas wie die 2 und 4 . Stelles des PWs oder so.

[gracjanski]

meine Antwort:

Zitat:

---

this is a joke, isnt it? Maybe you want my social number, and my DNA informations?

---

Deren Antwort:

Zitat:

---

Hello,

Thanks for contacting the Guild Wars customer support. Please accept our apologies for the mistake we made regarding your question. There is currently no plan regarding a reversal of the changes related to the langages districts. However, please note it is possible for you to join the American district, to give it a try, by following these steps :
- Log into Guild Wars with your account information
- At the Character selection, click on Edit Account in the lower left screen
- Select Change Territory and click Next
- Choose the desired territory from the list and click Change

Your account will then be moved to the chosen territory. Please be aware, that this procedure can only be repeated five times. After the fifth time, your account will be locked on the last chosen realm (This works almost like the region codes on your DVD-player or drive), and there is currently no way for us to move accounts that have exceeded their limit of territory changes. If you should encounter any further problems, please feel free to contact us again.

Have fun in Guild Wars!

Kind regards,
GM Robert
NCsoft Europe
Guild Wars Customer Support http://www.guildwars.com

---

schon mal :thu support. Jedoch There is currently no plan regarding a reversal of the changes related to the langages districts.

Lass uns sie weiterbombardieren mit Anfragen, die Distrikte sind scheisse.

[stereotyp]

Sorry, Gracjanski aber dein Englisch ist ja mal grottenschlecht....

Kein Wunder, dass der Supportmensch nicht verstanden hat, was du eigtl wolltest.

Und wieso schreibst du sie überhaupt auf English an? Hat NCsoft keinen deutschen Support ?!

[Ninjakuh]

Find sie mittlerweile sehr gut.

[GevatterTod]

Ein reversal, also eine Rückkehr zum alten Distriktesystem wird es sicher nicht geben. Im entsprechenden Umfragethread sind wir ja, wenn ich das richtig einschätze, darin überein gekommen, das es einen Europadistrikt geben sollte sowie die Möglichkeit, einen Standarddistrikt zu wählen. Letzteres sollte als absolutes Minimum in absehbarer Zeit eingeführt (sonst drehe ich am Rad). Vielleicht hättest du diese Idee mal vortragen sollen ...

Ich für meinen Teil warte, bis AmunRa&Co. diesbezüglich neue Informationen aus erster Hand haben (der Support wird mit Sicherheit nicht Himmel und Hölle in bewegung setzen, wenn en einzelner oder mehrer einzelne eine Anfrage an den Support richten. Da muß man andere Wege gehen.). Allerdings dauert mir das doch Recht lange. Aber warum? Wie läuft das ab? Etwa so?

Wartower: Hey ho guys, thanks for your great work .... bla bla praise bla bla bla ... but what about an european district and the opportunity to choose an stanadrtdistrikt?
Dev: Come back in seven years, three months, seventen days, twelve hours and twentythree minutes. Then I can tell you, if it is a good idea.

Warum dauert das solange (was kein Vorwurf an irgendjemanden sein soll)!?

[Mokular]

Zitat:

---

acgaatctagctgctagctacgactgatcactagctgtagctacgtacgt

---

Ich hab mal eine BLAST gemacht und muss Dir sagen:

...einer Deiner Vorfahren war ein Reiskorn und ein anderer eine Maus



Sequences producing significant alignments:

gi|58531193|dbj|AP008212.1| Oryza sativa (japonica cultivar-g...
gi|28610490|emb|AL833795.7| Mouse DNA sequence from clone RP2...
gi|53793017|dbj|AP004794.3| Oryza sativa (japonica cultivar-g...


...

Spaß beiseite

Die haben Deine Mail wohl wirklich in den falschen Hals gekriegt. Das sie es später noch gemerkt haben find ich aber klasse. Das hab ich von Kundendiensten aber schon ganz anders erlebt. Das sie dann sogar nicht dir die Schuld dafür gegeben haben ist auch leider bemerkenswert. (Hab ich auch schon anders erlebt)

[Milchknilch]

Zitat:

---

However, please note it is possible for you to join the American district,

---

Seh ich das richtig das Anet uns auffordert auf den Ami server zu kommen um die Districte zu umgehen
Yeah bald sind wir wieder vereint endlich keine Reals mehr.

[Horlem]

Zitat:

---

Ich hab mal eine BLAST gemacht und muss Dir sagen:

...einer Deiner Vorfahren war ein Reiskorn und ein anderer eine Maus

---

Er hat sich nur im Chromosom geirrt, es ist entweder 5 oder 9

AL353683 Human DNA sequence from clone RP1... 36.2 5.1
AC008426 Homo sapiens chromosome 5 clone CTC-3 36.2 5.1

Btw, E-value von >1, dann sind auch Maus und Katze das Gleiche.

Btt, die 2. Antwort von ANet find ich auch komisch. Nach dem Motto, wem es auf den Euroservern nicht gefaellt, soll doch zum Amiserver wechseln.
Gut, ein Grossteil ist schon gewechselt, aber wer soll den dann nach ANets Ansicht noch auf dem "Euroserver" kommen?